addgene pmd2 g (Addgene inc)
Addgene inc is a verified supplier 
98
Structured Review
Addgene inc
addgene pmd2 g
Addgene Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 14751 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pmd2+g+plasmid+addgene/pMD2%2EG+(Plasmid+%2312259)/pmc12857616-194-6-6
Average 98 stars, based on 14751 article reviews
Addgene Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 14751 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pmd2+g+plasmid+addgene/pMD2%2EG+(Plasmid+%2312259)/pmc12857616-194-6-6
Average 98 stars, based on 14751 article reviews
addgene pmd2 g - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Gene Expression:Article Title: Proteomic characterization of the colorectal cancer response to chemoradiation and targeted therapies reveals potential therapeutic strategies Article Snippet: Baker Cat# 9829-03 Hexadimethrine Bromide Sigma Cat# H9268 NONIDET P-40 SUBSTITUTE Amresco Cat# M158 Colchicine Sangon Biotech Cat# A600322-0100 Bradford Dye Reagent TaKaRa Cat# T9310A-1 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Scientific Cat# 34580 Lipofectamine 2000 Invitrogen Cat# 11668-019 Colchicine Sangon Biotech Cat# A600322-0100 DAPI Sigma Cat# D8417 Q Exactive HF-X Hybrid QuadrupoleOrbitrap Mass Spectrometer ThermoFisher Cat# 0726042 EASY-nLC 1200 system ThermoFisher Cat# LC140 Amersham Imager 600 GE Healthcare Bio-Sciences AB Cat# 66720240 iMark Microplate Reader BioRad Cat# 15001 Vacuum centrifuge Eppendorf Cat# 07-748-15 Critical commercial assays Easypure Plasmid Miniprep Kit TransGen Biotech Cat# EM101-02 RevertAid First Strand cDNA Synthesis Kit Thermo Scientific Cat# K1622 Cell Counting Kit-8 Beyotime Cat# C0046 Deposited data Proteomic data of the colorectal cancer cohort This paper iProx: IPX0002629000 ProteomeXchange: PXD046566 The TCGA cohort Zhang et al.11 https://cptac-data-portal.georgetown.edu Transcriptomic expression data of the rectal cancer patients Millino et al.32 GEO accession - GSE68204 (Continued on next page) e1 Cell Reports Medicine 4, 101311, December 19, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Global gene expression profiling of human colorectal cancer cell lines Medico et al.47 GEO accession - GSE59857 Transcriptional data from CRC patients receiving cetuximab therapy Khambata-Ford et al.50 GEO accession - GSE5851 Proteomic data from CRC patients receiving cetuximab therapy Li et al.13 OEP000729 Gene expression profiles from CRC patients receiving FOLFOX therapy Gene Expression Omnibus GEO accession - GSE19860 Experimental models: Cell lines Human: SW480 cell line ATCC RRID: CVCL_0546 Human: SW620 cell line ATCC RRID: CVCL_0547 Human: RKO cell line ATCC RRID: CVCL_0504 Human: HCT116 cell line ATCC RRID: CVCL_0291 Recombinant DNA plvx-PURO vector Takara Bio Cat# Recombinant:Article Title: Proteomic characterization of the colorectal cancer response to chemoradiation and targeted therapies reveals potential therapeutic strategies Article Snippet: Baker Cat# 9829-03 Hexadimethrine Bromide Sigma Cat# H9268 NONIDET P-40 SUBSTITUTE Amresco Cat# M158 Colchicine Sangon Biotech Cat# A600322-0100 Bradford Dye Reagent TaKaRa Cat# T9310A-1 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Scientific Cat# 34580 Lipofectamine 2000 Invitrogen Cat# 11668-019 Colchicine Sangon Biotech Cat# A600322-0100 DAPI Sigma Cat# D8417 Q Exactive HF-X Hybrid QuadrupoleOrbitrap Mass Spectrometer ThermoFisher Cat# 0726042 EASY-nLC 1200 system ThermoFisher Cat# LC140 Amersham Imager 600 GE Healthcare Bio-Sciences AB Cat# 66720240 iMark Microplate Reader BioRad Cat# 15001 Vacuum centrifuge Eppendorf Cat# 07-748-15 Critical commercial assays Easypure Plasmid Miniprep Kit TransGen Biotech Cat# EM101-02 RevertAid First Strand cDNA Synthesis Kit Thermo Scientific Cat# K1622 Cell Counting Kit-8 Beyotime Cat# C0046 Deposited data Proteomic data of the colorectal cancer cohort This paper iProx: IPX0002629000 ProteomeXchange: PXD046566 The TCGA cohort Zhang et al.11 https://cptac-data-portal.georgetown.edu Transcriptomic expression data of the rectal cancer patients Millino et al.32 GEO accession - GSE68204 (Continued on next page) e1 Cell Reports Medicine 4, 101311, December 19, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Global gene expression profiling of human colorectal cancer cell lines Medico et al.47 GEO accession - GSE59857 Transcriptional data from CRC patients receiving cetuximab therapy Khambata-Ford et al.50 GEO accession - GSE5851 Proteomic data from CRC patients receiving cetuximab therapy Li et al.13 OEP000729 Gene expression profiles from CRC patients receiving FOLFOX therapy Gene Expression Omnibus GEO accession - GSE19860 Experimental models: Cell lines Human: SW480 cell line ATCC RRID: CVCL_0546 Human: SW620 cell line ATCC RRID: CVCL_0547 Human: RKO cell line ATCC RRID: CVCL_0504 Human: HCT116 cell line ATCC RRID: CVCL_0291 Recombinant DNA plvx-PURO vector Takara Bio Cat# Article Title: Cancer cell-derived arginine fuels polyamine biosynthesis in tumor-associated macrophages to promote immune evasion. Article Snippet: Article Plasmid Preparation:Article Title: Proteomic characterization of the colorectal cancer response to chemoradiation and targeted therapies reveals potential therapeutic strategies Article Snippet: Baker Cat# 9829-03 Hexadimethrine Bromide Sigma Cat# H9268 NONIDET P-40 SUBSTITUTE Amresco Cat# M158 Colchicine Sangon Biotech Cat# A600322-0100 Bradford Dye Reagent TaKaRa Cat# T9310A-1 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Scientific Cat# 34580 Lipofectamine 2000 Invitrogen Cat# 11668-019 Colchicine Sangon Biotech Cat# A600322-0100 DAPI Sigma Cat# D8417 Q Exactive HF-X Hybrid QuadrupoleOrbitrap Mass Spectrometer ThermoFisher Cat# 0726042 EASY-nLC 1200 system ThermoFisher Cat# LC140 Amersham Imager 600 GE Healthcare Bio-Sciences AB Cat# 66720240 iMark Microplate Reader BioRad Cat# 15001 Vacuum centrifuge Eppendorf Cat# 07-748-15 Critical commercial assays Easypure Plasmid Miniprep Kit TransGen Biotech Cat# EM101-02 RevertAid First Strand cDNA Synthesis Kit Thermo Scientific Cat# K1622 Cell Counting Kit-8 Beyotime Cat# C0046 Deposited data Proteomic data of the colorectal cancer cohort This paper iProx: IPX0002629000 ProteomeXchange: PXD046566 The TCGA cohort Zhang et al.11 https://cptac-data-portal.georgetown.edu Transcriptomic expression data of the rectal cancer patients Millino et al.32 GEO accession - GSE68204 (Continued on next page) e1 Cell Reports Medicine 4, 101311, December 19, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Global gene expression profiling of human colorectal cancer cell lines Medico et al.47 GEO accession - GSE59857 Transcriptional data from CRC patients receiving cetuximab therapy Khambata-Ford et al.50 GEO accession - GSE5851 Proteomic data from CRC patients receiving cetuximab therapy Li et al.13 OEP000729 Gene expression profiles from CRC patients receiving FOLFOX therapy Gene Expression Omnibus GEO accession - GSE19860 Experimental models: Cell lines Human: SW480 cell line ATCC RRID: CVCL_0546 Human: SW620 cell line ATCC RRID: CVCL_0547 Human: RKO cell line ATCC RRID: CVCL_0504 Human: HCT116 cell line ATCC RRID: CVCL_0291 Recombinant DNA plvx-PURO vector Takara Bio Cat# Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. Supplementary Table 1: List of siRNA oligonucleotides, CRISPR guides, and plasmids Reagent Source Identifier Human YY1 siRNA Thermo Scientific Cat# 107093 Human RBBP6 siRNA Thermo Scientific Cat# 143012 Human EZH2 siRNA Thermo Scientific Cat# 107417 Human EIF3D siRNA Thermo Scientific Cat# 13545 gRNA targeting human PRKCI gene #1: Synthego N/A 5’- UUAAAUUAUCUUCAUGAGCG-3’ gRNA targeting human PRKCI gene #2: Synthego N/A 5’-CACUGACUACGGCAUGUGUA-3’ gRNA targeting human EZH2 gene: Synthego N/A 5’-CAGACAGUGAUAGGGAAGCA-3’ gRNA targeting mouse Prkci gene: Synthego N/A 5’-AGUCCCUCAAAGGAGAUGGA-3’ ssODN for human EZH2 editing: IDT N/A 5’GGCGGCCGCAGAAGAGGACGGCTTCCCAATAACAG TAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAA GCAAAGGATACAGACGCTGATAGGGAAGCAGGAACT GAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAA GAGAAGAAAGATGAAAC-3’ TRC lentiviral shRNA targeting human PRKCI Open Biosystems TRCN000000 6037 psPAX2 plasmid Addgene #12260 Article Title: Cancer cell-derived arginine fuels polyamine biosynthesis in tumor-associated macrophages to promote immune evasion. Article Snippet: Article Software:Article Title: Proteomic characterization of the colorectal cancer response to chemoradiation and targeted therapies reveals potential therapeutic strategies Article Snippet: Baker Cat# 9829-03 Hexadimethrine Bromide Sigma Cat# H9268 NONIDET P-40 SUBSTITUTE Amresco Cat# M158 Colchicine Sangon Biotech Cat# A600322-0100 Bradford Dye Reagent TaKaRa Cat# T9310A-1 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Scientific Cat# 34580 Lipofectamine 2000 Invitrogen Cat# 11668-019 Colchicine Sangon Biotech Cat# A600322-0100 DAPI Sigma Cat# D8417 Q Exactive HF-X Hybrid QuadrupoleOrbitrap Mass Spectrometer ThermoFisher Cat# 0726042 EASY-nLC 1200 system ThermoFisher Cat# LC140 Amersham Imager 600 GE Healthcare Bio-Sciences AB Cat# 66720240 iMark Microplate Reader BioRad Cat# 15001 Vacuum centrifuge Eppendorf Cat# 07-748-15 Critical commercial assays Easypure Plasmid Miniprep Kit TransGen Biotech Cat# EM101-02 RevertAid First Strand cDNA Synthesis Kit Thermo Scientific Cat# K1622 Cell Counting Kit-8 Beyotime Cat# C0046 Deposited data Proteomic data of the colorectal cancer cohort This paper iProx: IPX0002629000 ProteomeXchange: PXD046566 The TCGA cohort Zhang et al.11 https://cptac-data-portal.georgetown.edu Transcriptomic expression data of the rectal cancer patients Millino et al.32 GEO accession - GSE68204 (Continued on next page) e1 Cell Reports Medicine 4, 101311, December 19, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Global gene expression profiling of human colorectal cancer cell lines Medico et al.47 GEO accession - GSE59857 Transcriptional data from CRC patients receiving cetuximab therapy Khambata-Ford et al.50 GEO accession - GSE5851 Proteomic data from CRC patients receiving cetuximab therapy Li et al.13 OEP000729 Gene expression profiles from CRC patients receiving FOLFOX therapy Gene Expression Omnibus GEO accession - GSE19860 Experimental models: Cell lines Human: SW480 cell line ATCC RRID: CVCL_0546 Human: SW620 cell line ATCC RRID: CVCL_0547 Human: RKO cell line ATCC RRID: CVCL_0504 Human: HCT116 cell line ATCC RRID: CVCL_0291 Recombinant DNA plvx-PURO vector Takara Bio Cat# Article Title: Cancer cell-derived arginine fuels polyamine biosynthesis in tumor-associated macrophages to promote immune evasion. Article Snippet: Article other:Article Title: MYC activation impairs cell-intrinsic IFNγ signaling and confers resistance to anti-PD1/PD-L1 therapy in lung cancer Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HCC33 DMSZ Cat# ACC 487 LUDLU1 ECACC Cat# 92012463 PC14 ECACC Cat# 90071810 PDC11 Pros et al.15 N/A PDC12 Pros et al.15 N/A PDC14 Pros et al.15 N/A H1573 ATCC Cat# CRL-5877 H1993 ATCC Cat# CRL-5909 H2126 ATCC Cat# CCL-256 Oligonucleotides ICAM1-Forward: CACAGTCACCTATGGCAACG Integrated DNA Technologies (IDT) N/A ICAM1-reverse: CCTCTGGCTTCGTCAGAATC Integrated DNA Technologies (IDT) N/A IDO1-Forward: GGCAAAGGTCATGGAGATGT Integrated DNA Technologies (IDT) N/A IDO1-reverse: CTGCAGTCTCCATCACGAAA Integrated DNA Technologies (IDT) N/A PDCD1LG2-Forward: CCCTGGAATGCAACTTTGAC Integrated DNA Technologies (IDT) N/A PDCD1LG2-reverse: TGCATTGGTACTGTCCTTCG Integrated DNA Technologies (IDT) N/A SOCS1-Forward: CCCTTCTGTAGGATGGTAGCACAC Integrated DNA Technologies (IDT) N/A SOCS1-reverse: GGCTCTGCTGCTGTGGAGAC Integrated DNA Technologies (IDT) N/A TAP1-Forward: TGCTGAAAGTGGGAATCCTC Integrated DNA Technologies (IDT) N/A TAP1-reverse: GCCCACAGCCTTCTGTACTC Integrated DNA Technologies (IDT) Article Title: Engineering forward genetics into cultured cancer cells for chemical target identification Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Msh2 [D24B5] XP rabbit mAb Cell Signaling Technology Cat#2017 Anti-β-actin (8H10D10) mouse mAb Cell Signaling Technologies Cat#3700 IRDye 800CW donkey anti-rabbit IgG (H+L) LI-COR Cat#926-32213 IRDye 680RD donkey anti-mouse IgG (H+L) LI-COR Cat#926-68072 Bacterial and Virus Strains Biological Samples Chemicals, Peptides, and Recombinant Proteins Bortezomib Selleck Chemicals Cat#S1013; CAS ID: 179324-69-7 Etoposide Sigma-Aldrich Cat#E1383; CAS ID: 33419-42-0 CD437 Sigma-Aldrich Cat#C5865; CAS ID: 125316-60-1 MLN4924 ApexBio Cat#B1036; CAS ID: 905579-51-3 Critical Commercial Assays CellTiter-Glo luminescent cell viability assay Promega Cat#G7571 Deposited Data WES from human and mouse cell lines This paper SRA ID: PRJNA543281 Experimental Models: Cell Lines Ewing sarcoma A673 cell lines ATCC ATCC® CRL-1598TM Trp53fl/fl; Rb1fl/fl; Rbl2fl/fl; RosaLSL-Tomato/+ murine SCLC cell lines This paper N/A 293T/17 ATCC ATCC® CRL-11268TM Experimental Models: Organisms/Strains Mouse: Trp53 fl/fl Rb fl/fl P130 fl/fl Schaffer et al., 2010 Mouse: Trp53 fl/fl JAX: 008462 Mouse: Rb fl/fl JAX: 008186 Mouse: P130 fl/fl JAX: 008177 Oligonucleotides Primers for PCR and sequencing of PSMB5 and POLA1 , see Table S3 This CRISPR:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. Supplementary Table 1: List of siRNA oligonucleotides, CRISPR guides, and plasmids Reagent Source Identifier Human YY1 siRNA Thermo Scientific Cat# 107093 Human RBBP6 siRNA Thermo Scientific Cat# 143012 Human EZH2 siRNA Thermo Scientific Cat# 107417 Human EIF3D siRNA Thermo Scientific Cat# 13545 gRNA targeting human PRKCI gene #1: Synthego N/A 5’- UUAAAUUAUCUUCAUGAGCG-3’ gRNA targeting human PRKCI gene #2: Synthego N/A 5’-CACUGACUACGGCAUGUGUA-3’ gRNA targeting human EZH2 gene: Synthego N/A 5’-CAGACAGUGAUAGGGAAGCA-3’ gRNA targeting mouse Prkci gene: Synthego N/A 5’-AGUCCCUCAAAGGAGAUGGA-3’ ssODN for human EZH2 editing: IDT N/A 5’GGCGGCCGCAGAAGAGGACGGCTTCCCAATAACAG TAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAA GCAAAGGATACAGACGCTGATAGGGAAGCAGGAACT GAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAA GAGAAGAAAGATGAAAC-3’ TRC lentiviral shRNA targeting human PRKCI Open Biosystems TRCN000000 6037 psPAX2 plasmid Addgene #12260 shRNA:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. Supplementary Table 1: List of siRNA oligonucleotides, CRISPR guides, and plasmids Reagent Source Identifier Human YY1 siRNA Thermo Scientific Cat# 107093 Human RBBP6 siRNA Thermo Scientific Cat# 143012 Human EZH2 siRNA Thermo Scientific Cat# 107417 Human EIF3D siRNA Thermo Scientific Cat# 13545 gRNA targeting human PRKCI gene #1: Synthego N/A 5’- UUAAAUUAUCUUCAUGAGCG-3’ gRNA targeting human PRKCI gene #2: Synthego N/A 5’-CACUGACUACGGCAUGUGUA-3’ gRNA targeting human EZH2 gene: Synthego N/A 5’-CAGACAGUGAUAGGGAAGCA-3’ gRNA targeting mouse Prkci gene: Synthego N/A 5’-AGUCCCUCAAAGGAGAUGGA-3’ ssODN for human EZH2 editing: IDT N/A 5’GGCGGCCGCAGAAGAGGACGGCTTCCCAATAACAG TAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAA GCAAAGGATACAGACGCTGATAGGGAAGCAGGAACT GAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAA GAGAAGAAAGATGAAAC-3’ TRC lentiviral shRNA targeting human PRKCI Open Biosystems TRCN000000 6037 psPAX2 plasmid Addgene #12260 Article Title: Cancer cell-derived arginine fuels polyamine biosynthesis in tumor-associated macrophages to promote immune evasion. Article Snippet: Article Real-time Polymerase Chain Reaction:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. Supplementary Table 1: List of siRNA oligonucleotides, CRISPR guides, and plasmids Reagent Source Identifier Human YY1 siRNA Thermo Scientific Cat# 107093 Human RBBP6 siRNA Thermo Scientific Cat# 143012 Human EZH2 siRNA Thermo Scientific Cat# 107417 Human EIF3D siRNA Thermo Scientific Cat# 13545 gRNA targeting human PRKCI gene #1: Synthego N/A 5’- UUAAAUUAUCUUCAUGAGCG-3’ gRNA targeting human PRKCI gene #2: Synthego N/A 5’-CACUGACUACGGCAUGUGUA-3’ gRNA targeting human EZH2 gene: Synthego N/A 5’-CAGACAGUGAUAGGGAAGCA-3’ gRNA targeting mouse Prkci gene: Synthego N/A 5’-AGUCCCUCAAAGGAGAUGGA-3’ ssODN for human EZH2 editing: IDT N/A 5’GGCGGCCGCAGAAGAGGACGGCTTCCCAATAACAG TAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAA GCAAAGGATACAGACGCTGATAGGGAAGCAGGAACT GAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAA GAGAAGAAAGATGAAAC-3’ TRC lentiviral shRNA targeting human PRKCI Open Biosystems TRCN000000 6037 psPAX2 plasmid Addgene #12260 Article Title: Cancer cell-derived arginine fuels polyamine biosynthesis in tumor-associated macrophages to promote immune evasion. Article Snippet: Article Sequencing:Article Title: Cancer cell-derived arginine fuels polyamine biosynthesis in tumor-associated macrophages to promote immune evasion. Article Snippet: Article |